p4083 fbs gibco cat (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
96
Structured Review
Thermo Fisher
p4083 fbs gibco cat
P4083 Fbs Gibco Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p4083+fbs+gibco+cat/L(%2B)-Arginine+hydrochloride/pm41708984-209-116-118
Average 96 stars, based on 1 article reviews
P4083 Fbs Gibco Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p4083+fbs+gibco+cat/L(%2B)-Arginine+hydrochloride/pm41708984-209-116-118
Average 96 stars, based on 1 article reviews
p4083 fbs gibco cat - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Recombinant:Article Title: Integrative multi-omics defines melanoma drug response networks and ARID1A-dependent resistance mechanisms. Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models A375 Synthego A375-ARID1A KO Synthego Recombinant DNA Antibodies Anti-EGFR - Alexa 488 Biolegend Clone AY13, Cat 352907 Anti-HLA-DQ Biolegend Clone HLADQ1, Cat 318105 Anti-HLA-DR ebioscences Clone LN3, Cat 17- 9956-41 Oligonucleotides and other sequence-based reagents EGFR guide 1 forward sequence: CACCGTACACCGTGCCGAACGCAC Sigma EGFR guide 1 reverse sequence: AAACGTGCGTTCGGCACGGTGTAC Sigma EGFR guide 2 forward sequence: CACCGTAGTTAGATAAGACTGCTA Sigma 10 Molecular Systems Biology © European Molecular Biology Laboratory and the Authors Reagent/resource Reference or source Identifier or catalog number EGFR guide 2 reverse sequence: AAACTAGCAGTCTTATCTAACTAC Sigma Chemicals, enzymes, and other reagents Trametinib APExBio Cat. No.: A3018 Vemurafenib APExBio Cat. No.: A3004 Penicillin/Streptomycin/Neomycin Sigma Cat. No.: Sequencing:Article Title: Integrative multi-omics defines melanoma drug response networks and ARID1A-dependent resistance mechanisms. Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models A375 Synthego A375-ARID1A KO Synthego Recombinant DNA Antibodies Anti-EGFR - Alexa 488 Biolegend Clone AY13, Cat 352907 Anti-HLA-DQ Biolegend Clone HLADQ1, Cat 318105 Anti-HLA-DR ebioscences Clone LN3, Cat 17- 9956-41 Oligonucleotides and other sequence-based reagents EGFR guide 1 forward sequence: CACCGTACACCGTGCCGAACGCAC Sigma EGFR guide 1 reverse sequence: AAACGTGCGTTCGGCACGGTGTAC Sigma EGFR guide 2 forward sequence: CACCGTAGTTAGATAAGACTGCTA Sigma 10 Molecular Systems Biology © European Molecular Biology Laboratory and the Authors Reagent/resource Reference or source Identifier or catalog number EGFR guide 2 reverse sequence: AAACTAGCAGTCTTATCTAACTAC Sigma Chemicals, enzymes, and other reagents Trametinib APExBio Cat. No.: A3018 Vemurafenib APExBio Cat. No.: A3004 Penicillin/Streptomycin/Neomycin Sigma Cat. No.: Lysis:Article Title: Integrative multi-omics defines melanoma drug response networks and ARID1A-dependent resistance mechanisms. Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models A375 Synthego A375-ARID1A KO Synthego Recombinant DNA Antibodies Anti-EGFR - Alexa 488 Biolegend Clone AY13, Cat 352907 Anti-HLA-DQ Biolegend Clone HLADQ1, Cat 318105 Anti-HLA-DR ebioscences Clone LN3, Cat 17- 9956-41 Oligonucleotides and other sequence-based reagents EGFR guide 1 forward sequence: CACCGTACACCGTGCCGAACGCAC Sigma EGFR guide 1 reverse sequence: AAACGTGCGTTCGGCACGGTGTAC Sigma EGFR guide 2 forward sequence: CACCGTAGTTAGATAAGACTGCTA Sigma 10 Molecular Systems Biology © European Molecular Biology Laboratory and the Authors Reagent/resource Reference or source Identifier or catalog number EGFR guide 2 reverse sequence: AAACTAGCAGTCTTATCTAACTAC Sigma Chemicals, enzymes, and other reagents Trametinib APExBio Cat. No.: A3018 Vemurafenib APExBio Cat. No.: A3004 Penicillin/Streptomycin/Neomycin Sigma Cat. No.: Protease Inhibitor:Article Title: Integrative multi-omics defines melanoma drug response networks and ARID1A-dependent resistance mechanisms. Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models A375 Synthego A375-ARID1A KO Synthego Recombinant DNA Antibodies Anti-EGFR - Alexa 488 Biolegend Clone AY13, Cat 352907 Anti-HLA-DQ Biolegend Clone HLADQ1, Cat 318105 Anti-HLA-DR ebioscences Clone LN3, Cat 17- 9956-41 Oligonucleotides and other sequence-based reagents EGFR guide 1 forward sequence: CACCGTACACCGTGCCGAACGCAC Sigma EGFR guide 1 reverse sequence: AAACGTGCGTTCGGCACGGTGTAC Sigma EGFR guide 2 forward sequence: CACCGTAGTTAGATAAGACTGCTA Sigma 10 Molecular Systems Biology © European Molecular Biology Laboratory and the Authors Reagent/resource Reference or source Identifier or catalog number EGFR guide 2 reverse sequence: AAACTAGCAGTCTTATCTAACTAC Sigma Chemicals, enzymes, and other reagents Trametinib APExBio Cat. No.: A3018 Vemurafenib APExBio Cat. No.: A3004 Penicillin/Streptomycin/Neomycin Sigma Cat. No.: Software:Article Title: Integrative multi-omics defines melanoma drug response networks and ARID1A-dependent resistance mechanisms. Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models A375 Synthego A375-ARID1A KO Synthego Recombinant DNA Antibodies Anti-EGFR - Alexa 488 Biolegend Clone AY13, Cat 352907 Anti-HLA-DQ Biolegend Clone HLADQ1, Cat 318105 Anti-HLA-DR ebioscences Clone LN3, Cat 17- 9956-41 Oligonucleotides and other sequence-based reagents EGFR guide 1 forward sequence: CACCGTACACCGTGCCGAACGCAC Sigma EGFR guide 1 reverse sequence: AAACGTGCGTTCGGCACGGTGTAC Sigma EGFR guide 2 forward sequence: CACCGTAGTTAGATAAGACTGCTA Sigma 10 Molecular Systems Biology © European Molecular Biology Laboratory and the Authors Reagent/resource Reference or source Identifier or catalog number EGFR guide 2 reverse sequence: AAACTAGCAGTCTTATCTAACTAC Sigma Chemicals, enzymes, and other reagents Trametinib APExBio Cat. No.: A3018 Vemurafenib APExBio Cat. No.: A3004 Penicillin/Streptomycin/Neomycin Sigma Cat. No.: |